This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003657


Marker Name:  SW335 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: GAGTATGGGGAAAGCCACG
Primer: CCATCAACAAACTGTATGCACC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008849

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
2758104.000 2758154.500 2758205.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
2643414.000 2643464.500 2643515.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
3115596.000 3115646.500 3115697.000
Nordic v2 (A): 17 Pig
chromosome 17
0.000 0.000 0.000
Nordic v2 (F): 17 Pig
chromosome 17
0.000 0.000 0.000
Nordic v2 (M): 17 Pig
chromosome 17
0.000 0.000 0.000
USDA-MARC current (A): 17 Pig
chromosome 17
0.000 0.000 0.000
USDA-MARC v1 (A): 17 Pig
chromosome 17
0.000 0.000 0.000
USDA-MARC v2 (A): 17 Pig
chromosome 17
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved