This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003654


Marker Name:  SW328 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: GATCCAAACTGCCATTCTATTG
Primer: CAGGGGTGGCGCTAGAAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008845

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
115314571.000 115314643.000 115314715.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
114542373.000 114542445.000 114542517.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
119207302.000 119207374.000 119207446.000
USDA-MARC v1 (A): 14 Pig
chromosome 14
61.600 61.600 61.600
USDA-MARC v2 (A): 14 Pig
chromosome 14
59.300 59.300 59.300


© The Roslin Institute 2007-2012, all rights reserved