This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003644


Marker Name:  SW305 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: AGCTTTCATTTTTTTAACCCATC
Primer: TCACCTTTCAACCCATCACC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008837

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
42975614.000 42975671.500 42975729.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
54149294.000 54149351.500 54149409.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
62778258.000 62778315.500 62778373.000
USDA-MARC v1 (A): 10 Pig
chromosome 10
104.300 104.300 104.300
USDA-MARC v2 (A): 10 Pig
chromosome 10
90.200 90.200 90.200


© The Roslin Institute 2007-2012, all rights reserved