This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003640


Marker Name:  SW295 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: ACCTGCCAGAGTTGTGGC
Primer: AAGAGTTTCATTTCTCCCATCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008834

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
39439067.000 39439133.500 39439200.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
39158667.000 39158733.500 39158800.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
41217524.000 41217590.500 41217657.000
PiGMaP SSC14 v1.5 (A): 14 Pig
chromosome 14
87.200 87.200 87.200
PiGMaP SSC14 v1.5 (F): 14 Pig
chromosome 14
84.900 84.900 84.900
PiGMaP SSC14 v1.5 (M): 14 Pig
chromosome 14
91.100 91.100 91.100
USDA-MARC v1 (A): 14 Pig
chromosome 14
93.600 93.600 93.600
USDA-MARC v2 (A): 14 Pig
chromosome 14
35.700 35.700 35.700


© The Roslin Institute 2007-2012, all rights reserved