This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003638


Marker Name:  SW288 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: AAAATAAAAAGCATGGCCTGC
Primer: GGGAAAAAACATGTAATTGCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008832

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
63146061.000 63146127.000 63146193.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
62606613.000 62606679.000 62606745.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
65129650.000 65129716.000 65129782.000
USDA-MARC v1 (A): 14 Pig
chromosome 14
83.600 83.600 83.600
USDA-MARC v2 (A): 14 Pig
chromosome 14
44.600 44.600 44.600


© The Roslin Institute 2007-2012, all rights reserved