This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003637


Marker Name:  SW287 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TTGAAGTCTACCCATGTTGTTG
Primer: CATCCCAATGTGCACTGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008831

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
23418878.000 23418958.000 23419038.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
23000042.000 23000122.000 23000202.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
24615060.000 24615140.000 24615220.000
USDA-MARC v1 (A): 14 Pig
chromosome 14
100.100 100.100 100.100
USDA-MARC v2 (A): 14 Pig
chromosome 14
29.000 29.000 29.000


© The Roslin Institute 2007-2012, all rights reserved