This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003633


Marker Name:  SW271 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TTCCAGTGGCTTTCTGTGC
Primer: CATTCATTCCCAGTGAAACTTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008828

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 3 Pig
chromosome 3
46501853.000 46501925.000 46501997.000
ENSEMBL56 Sscrofa9 Pig Assembly: 3 Pig
chromosome 3
74962563.000 74962635.000 74962707.000
ENSEMBL67 Ssc10.2 Pig Assembly: 3 Pig
chromosome 3
85313861.000 85313933.000 85314005.000
USDA-MARC v1 (A): 3 Pig
chromosome 3
93.000 93.000 93.000
USDA-MARC v2 (A): 3 Pig
chromosome 3
70.100 70.100 70.100


© The Roslin Institute 2007-2012, all rights reserved