This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003616


Marker Name:  SW2604 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: AGGATGGAGGTTGAGAGTCG
Primer: AGCAATTATCTTGCTCTTAGCAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008817
has an Associated Sequence: Local Sequence ID: ARKFSQ00008818

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
84305526.000 84305621.500 84305717.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
84167608.000 84167703.500 84167799.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
84843417.000 84843512.500 84843608.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
84981335.000 84981430.500 84981526.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
88109674.000 88109769.500 88109865.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
46.300 46.300 46.300


© The Roslin Institute 2007-2012, all rights reserved