This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003614


Marker Name:  SW26 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TGAGTGCAATGAAGCCAATC
Primer: TTTACCCCACCTGCCAAAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008815
has an Associated Sequence: Local Sequence ID: ARKFSQ00008816

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
23887915.000 23887987.500 23888060.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
23671079.000 23671151.500 23671224.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
22531484.000 22531556.500 22531629.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
22744772.000 22744844.500 22744917.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
24310612.000 24310684.500 24310757.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
27.800 27.800 27.800


© The Roslin Institute 2007-2012, all rights reserved