This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003579


Marker Name:  SW2520 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: AATAACTGGTCTGCTTGAAGCC
Primer: GTGTACATGTTGTGAAAGGGTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008793

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
92249231.000 92249299.500 92249368.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
96105008.000 96105076.500 96105145.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
52.100 52.100 52.100


© The Roslin Institute 2007-2012, all rights reserved