This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003576


Marker Name:  SW2519 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: CGTCTTCCCAGTAGGCTTTG
Primer: GGATACTAAGTGTCTCCCCCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008791

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
89311478.000 89311584.000 89311690.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
89250610.000 89250716.000 89250822.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
89963000.000 89963106.000 89963212.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
93372131.000 93372237.000 93372343.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
51.000 51.000 51.000


© The Roslin Institute 2007-2012, all rights reserved