This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003573


Marker Name:  SW2515 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: CCATCTCATCCAGAAACATCC
Primer: AGGATGCTGAGGTGTTAGGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008789

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
145360928.000 145360977.500 145361027.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
145499865.000 145499914.500 145499964.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
145107504.000 145107553.500 145107603.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
149890749.000 149890798.500 149890848.000
Fernandez, A et al 2003 (A): 14 Pig
chromosome 14
128.100 128.100 128.100
NIAI-Japan QTL v2 (A): 14 Pig
chromosome 14
173.800 173.800 173.800
NIAI-Japan v1 (A): 14 Pig
chromosome 14
162.200 162.200 162.200
NIAI-Japan v1 (F): 14 Pig
chromosome 14
204.000 204.000 204.000
NIAI-Japan v1 (M): 14 Pig
chromosome 14
127.100 127.100 127.100
USDA-MARC v2 (A): 14 Pig
chromosome 14
108.700 108.700 108.700


© The Roslin Institute 2007-2012, all rights reserved