This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003561


Marker Name:  SW2508 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: ATAGGATGCTGTGCACATGC
Primer: GCTAAGTTTGTCCACCACACTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008786

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
35639861.000 35639913.500 35639966.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
35333414.000 35333466.500 35333519.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
37313004.000 37313056.500 37313109.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
33.600 33.600 33.600


© The Roslin Institute 2007-2012, all rights reserved