This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003554


Marker Name:  SW2496 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TATAGCATTTGGATGTTCCACG
Primer: GCCCAAATAAAGTGGTCTATGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
16066507.000 16066623.000 16066739.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
21.500 21.500 21.500


© The Roslin Institute 2007-2012, all rights reserved