This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003545


Marker Name:  SW249 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: GAAAGCAGGACTTGCTCCTG
Primer: ATCATCACTCTCCCAACATGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
10227060.000 10227136.500 10227213.000
Nordic v2 (A): 10 Pig
chromosome 10
27.500 27.500 27.500
Nordic v2 (F): 10 Pig
chromosome 10
32.900 32.900 32.900
Nordic v2 (M): 10 Pig
chromosome 10
23.500 23.500 23.500
USDA-MARC v1 (A): 10 Pig
chromosome 10
13.500 13.500 13.500
USDA-MARC v2 (A): 10 Pig
chromosome 10
17.300 17.300 17.300


© The Roslin Institute 2007-2012, all rights reserved