This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003465


Marker Name:  SW2195 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TCCTGAGAGGCTTAGGATGG
Primer: TCCCTTCTATGGGGTGTGTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008746

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
17644375.000 17644456.000 17644537.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
22391508.000 22391589.000 22391670.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
25917876.000 25917957.000 25918038.000
USDA-MARC v2 (A): 10 Pig
chromosome 10
44.000 44.000 44.000


© The Roslin Institute 2007-2012, all rights reserved