This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003454


Marker Name:  SW2160 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TCTGCTTTTTTTCCCCCTG
Primer: TTTCTCAGCAATCTGATTGGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
USDA-MARC v2 (A): 8 Pig
chromosome 8
80.100 80.100 80.100
Zhang, Jingu et al 2007 (A): 8 Pig
chromosome 8
139.800 139.800 139.800
Zhang, Jingu et al 2007 (F): 8 Pig
chromosome 8
133.100 133.100 133.100
Zhang, Jingu et al 2007 (M): 8 Pig
chromosome 8
143.100 143.100 143.100


© The Roslin Institute 2007-2012, all rights reserved