This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003423


Marker Name:  SW2067 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: GAAGAAATTAAATGCACGTCCC
Primer: TTGCTGCTTGTGCCTTTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008714

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
62416542.000 62416608.000 62416674.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
72237308.000 72237374.000 72237440.000
USDA-MARC v2 (A): 10 Pig
chromosome 10
124.100 124.100 124.100


© The Roslin Institute 2007-2012, all rights reserved