This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003418


Marker Name:  SW2057 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: CAAATGGTTAGGATGCATTTG
Primer: ATTGCTTCCATCGGTTGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008710

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
118920927.000 118921025.500 118921124.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
118267919.000 118268017.500 118268116.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
123140217.000 123140315.500 123140414.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
62.400 62.400 62.400


© The Roslin Institute 2007-2012, all rights reserved