This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003393


Marker Name:  SW1991 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: CTCTTGCAAACTCCACCCTC
Primer: ACCACATAGATATAACCCCCCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008691

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
33093805.000 33093901.000 33093997.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
40774654.000 40774750.000 40774846.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
46980658.000 46980754.000 46980850.000
USDA-MARC v2 (A): 10 Pig
chromosome 10
79.400 79.400 79.400


© The Roslin Institute 2007-2012, all rights reserved