This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003384


Marker Name:  SW1975 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: CAGCGGACTTAAGGCATCTC
Primer: TTGAAGCTAACGCTGGGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008683

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
31416029.000 31416081.000 31416133.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
31114657.000 31114709.000 31114761.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
32915907.000 32915959.000 32916011.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
33.100 33.100 33.100


© The Roslin Institute 2007-2012, all rights reserved