This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003376


Marker Name:  SW1953 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TATTCAAATCGTGTTCCAGCC
Primer: GAACCTGCTGTGTCTACAGCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008676

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 8 Pig
chromosome 8
25282337.000 25282413.000 25282489.000
ENSEMBL56 Sscrofa9 Pig Assembly: 8 Pig
chromosome 8
34089810.000 34089886.000 34089962.000
ENSEMBL67 Ssc10.2 Pig Assembly: 8 Pig
chromosome 8
41898215.000 41898291.000 41898367.000
USDA-MARC v2 (A): 8 Pig
chromosome 8
58.200 58.200 58.200
Zhang, Jingu et al 2007 (A): 8 Pig
chromosome 8
124.300 124.300 124.300
Zhang, Jingu et al 2007 (F): 8 Pig
chromosome 8
116.200 116.200 116.200
Zhang, Jingu et al 2007 (M): 8 Pig
chromosome 8
129.800 129.800 129.800


© The Roslin Institute 2007-2012, all rights reserved