This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003365


Marker Name:  SW1920 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: GATCCGTATCTATAGCCACCTG
Primer: ATGAAAGCTACCAACCCTTCC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008667

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
34546505.000 34546561.500 34546618.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
40104805.000 40104861.500 40104918.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
43234744.000 43234800.500 43234857.000
USDA-MARC current (A): 17 Pig
chromosome 17
56.400 56.400 56.400
USDA-MARC v2 (A): 17 Pig
chromosome 17
56.400 56.400 56.400


© The Roslin Institute 2007-2012, all rights reserved