This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003272


Marker Name:  SW163 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: GCTATCCCTGAGAAACAGTGTT
Primer: GATCCTAATGGGCTCAGCC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
78.200 78.200 78.200
NIAI-Japan v1 (A): 13 Pig
chromosome 13
68.300 68.300 68.300
NIAI-Japan v1 (F): 13 Pig
chromosome 13
84.000 84.000 84.000
NIAI-Japan v1 (M): 13 Pig
chromosome 13
54.800 54.800 54.800
USDA-MARC v2 (A): 13 Pig
chromosome 13
62.200 62.200 62.200


© The Roslin Institute 2007-2012, all rights reserved