This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003262


Marker Name:  SW160 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TCTTCCTTGTCATACATGCCC
Primer: ACTAGACAGCCAGGGTGGG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL67 Ssc10.2 Pig Assembly: 3 Pig
chromosome 3
97532603.000 97532667.500 97532732.000
USDA-MARC v1 (A): 3 Pig
chromosome 3
96.000 96.000 96.000
USDA-MARC v2 (A): 3 Pig
chromosome 3
72.100 72.100 72.100


© The Roslin Institute 2007-2012, all rights reserved