This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003255


Marker Name:  SW1556 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TCCCAGCACCTTGATTTTAG
Primer: AGGTTGCTGGAGATAGTGAAGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008575

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
86962068.000 86962179.000 86962290.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
87616064.000 87616175.000 87616286.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
90943621.000 90943732.000 90943843.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
51.000 51.000 51.000


© The Roslin Institute 2007-2012, all rights reserved