This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003247


Marker Name:  SW1536 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: CAGGCTGCACATGCTGTC
Primer: ATAGTGGGAATCCCCCAAAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008569

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
80609606.000 80609678.500 80609751.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
80964771.000 80964843.500 80964916.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
83873248.000 83873320.500 83873393.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
47.100 47.100 47.100


© The Roslin Institute 2007-2012, all rights reserved