This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003198


Marker Name:  SW1425 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TAAACACAGGGCGGATTTTC
Primer: TCTTTTCCCACCAACTTTGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008528

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
67353193.000 67353276.000 67353359.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
66972366.000 66972449.000 66972532.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
69427237.000 69427320.000 69427403.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
45.200 45.200 45.200


© The Roslin Institute 2007-2012, all rights reserved