This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003184


Marker Name:  SW1405 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TTCTAAGAAACTTTTCAACAGCC
Primer: GATCTCACTTGTGAGTGGAATC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008520

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
29071486.000 29071542.000 29071598.000
ENSEMBL56 Sscrofa9 Pig Assembly: 10 Pig
chromosome 10
35287318.000 35287374.000 35287430.000
ENSEMBL67 Ssc10.2 Pig Assembly: 10 Pig
chromosome 10
41125433.000 41125489.000 41125545.000
USDA-MARC v2 (A): 10 Pig
chromosome 10
67.500 67.500 67.500


© The Roslin Institute 2007-2012, all rights reserved