This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003109


Marker Name:  SW1129 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: CACAGGGGGAACACCTTAAT
Primer: GATCATATGAGGAAAAGAATGTGT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008474

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 6 Pig
chromosome 6
18922015.000 18922089.000 18922163.000
ENSEMBL56 Sscrofa9 Pig Assembly: 6 Pig
chromosome 6
40041073.000 40041147.000 40041221.000
ENSEMBL67 Ssc10.2 Pig Assembly: 6 Pig
chromosome 6
52757738.000 52757812.000 52757886.000
Intl Wrkshp.1 (A): 6 Pig
chromosome 6
104.100 104.100 104.100
Intl Wrkshp.1 (F): 6 Pig
chromosome 6
131.300 131.300 131.300
Intl Wrkshp.1 (M): 6 Pig
chromosome 6
77.300 77.300 77.300
Nordic v2 (A): 6 Pig
chromosome 6
83.700 83.700 83.700
Nordic v2 (F): 6 Pig
chromosome 6
108.200 108.200 108.200
Nordic v2 (M): 6 Pig
chromosome 6
62.800 62.800 62.800
USDA-BARC.6 (A): 6 Pig
chromosome 6
60.500 60.500 60.500
USDA-BARC.6 (F): 6 Pig
chromosome 6
85.000 85.000 85.000
USDA-BARC.6 (M): 6 Pig
chromosome 6
44.400 44.400 44.400
USDA-MARC SSC6 v2.5 (A): 6 Pig
chromosome 6
63.300 63.300 63.300
USDA-MARC SSC6 v2.5 (F): 6 Pig
chromosome 6
74.700 74.700 74.700
USDA-MARC SSC6 v2.5 (M): 6 Pig
chromosome 6
53.200 53.200 53.200
USDA-MARC v1 (A): 6 Pig
chromosome 6
54.900 54.900 54.900
USDA-MARC v2 (A): 6 Pig
chromosome 6
80.200 80.200 80.200
Zhang, Jingu et al 2007 (A): 6 Pig
chromosome 6
88.700 88.700 88.700
Zhang, Jingu et al 2007 (F): 6 Pig
chromosome 6
100.400 100.400 100.400
Zhang, Jingu et al 2007 (M): 6 Pig
chromosome 6
80.600 80.600 80.600


© The Roslin Institute 2007-2012, all rights reserved