This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003095


Marker Name:  SW1109 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TGCGGTTTCCTCTTGATTTC
Primer: GGCAAACAAATTGGTTTCTTAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008467

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
95075224.000 95075267.000 95075310.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
94068486.000 94068529.000 94068572.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
98135901.000 98135944.000 98135987.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
98191444.000 98191487.000 98191530.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
53.200 53.200 53.200


© The Roslin Institute 2007-2012, all rights reserved