This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003088


Marker Name:  SW1085 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: CAGGCTCCCTGACTTCAGAC
Primer: TAGGTCCATCCATGTTTCTGC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 1 Pig
chromosome 1
161960541.000 161961247.000 161961953.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 10 Pig
chromosome 10
24110053.000 24110618.500 24111184.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 8 Pig
chromosome 8
79699397.000 79699459.500 79699522.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 9 Pig
chromosome 9
37756108.000 37756769.000 37757430.000
Jann et al. 2009: 8 Pig
chromosome 8
2668.100 2668.100 2668.100
NIAI-Japan QTL v2 (A): 8 Pig
chromosome 8
106.300 106.300 106.300
NIAI-Japan v1 (A): 8 Pig
chromosome 8
106.300 106.300 106.300
NIAI-Japan v1 (F): 8 Pig
chromosome 8
121.900 121.900 121.900
NIAI-Japan v1 (M): 8 Pig
chromosome 8
91.000 91.000 91.000
USDA-MARC v1 (A): 8 Pig
chromosome 8
117.200 117.200 117.200
USDA-MARC v2 (A): 8 Pig
chromosome 8
99.000 99.000 99.000
Zhang, Jingu et al 2007 (A): 8 Pig
chromosome 8
161.700 161.700 161.700
Zhang, Jingu et al 2007 (F): 8 Pig
chromosome 8
153.500 153.500 153.500
Zhang, Jingu et al 2007 (M): 8 Pig
chromosome 8
166.400 166.400 166.400


© The Roslin Institute 2007-2012, all rights reserved