This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003073


Marker Name:  SW1057 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: TCCCCTGTTGTACAGATTGATG
Primer: TCCAATTCCAAGTTCCACTAGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008451

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Clop, Alex et al 2003 (A): 6 Pig
chromosome 6
44.300 44.300 44.300
ENSEMBL52PRE Sscrofa8 Pig Assembly: 6 Pig
chromosome 6
6830864.000 6830941.000 6831018.000
ENSEMBL56 Sscrofa9 Pig Assembly: 6 Pig
chromosome 6
18064381.000 18064458.000 18064535.000
ENSEMBL67 Ssc10.2 Pig Assembly: 6 Pig
chromosome 6
19536155.000 19536232.000 19536309.000
Intl Wrkshp.1 (A): 6 Pig
chromosome 6
51.300 51.300 51.300
Intl Wrkshp.1 (F): 6 Pig
chromosome 6
60.900 60.900 60.900
Intl Wrkshp.1 (M): 6 Pig
chromosome 6
39.000 39.000 39.000
Kopecny, M et al 2004 (A): 6 Pig
chromosome 6
0.000 0.000 0.000
NIAI-Japan QTL v2 (A): 6 Pig
chromosome 6
61.900 61.900 61.900
NIAI-Japan v1 (A): 6 Pig
chromosome 6
44.300 44.300 44.300
NIAI-Japan v1 (F): 6 Pig
chromosome 6
53.600 53.600 53.600
NIAI-Japan v1 (M): 6 Pig
chromosome 6
42.700 42.700 42.700
Nordic v2 (A): 6 Pig
chromosome 6
49.700 49.700 49.700
Nordic v2 (F): 6 Pig
chromosome 6
64.200 64.200 64.200
Nordic v2 (M): 6 Pig
chromosome 6
37.900 37.900 37.900
USDA-BARC.6 (A): 6 Pig
chromosome 6
25.800 25.800 25.800
USDA-BARC.6 (F): 6 Pig
chromosome 6
29.200 29.200 29.200
USDA-BARC.6 (M): 6 Pig
chromosome 6
21.700 21.700 21.700
USDA-MARC SSC6 v2.5 (A): 6 Pig
chromosome 6
25.200 25.200 25.200
USDA-MARC SSC6 v2.5 (F): 6 Pig
chromosome 6
28.600 28.600 28.600
USDA-MARC SSC6 v2.5 (M): 6 Pig
chromosome 6
20.900 20.900 20.900
USDA-MARC v1 (A): 6 Pig
chromosome 6
120.800 120.800 120.800
USDA-MARC v2 (A): 6 Pig
chromosome 6
47.100 47.100 47.100


© The Roslin Institute 2007-2012, all rights reserved