This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003069


Marker Name:  SW1045 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: GGTTTTATCTTTTTCCACAAAGG
Primer: GTGAGCCCAGCCTCAAAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
USDA-MARC v1 (A): 3 Pig
chromosome 3
68.800 68.800 68.800
USDA-MARC v2 (A): 3 Pig
chromosome 3
57.800 57.800 57.800


© The Roslin Institute 2007-2012, all rights reserved