This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003060


Marker Name:  SW1032 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: ATTGGGTGGACTGATATGGT
Primer: GATCTATAAAGTGTAAATTGTGTGTG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008444

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
67733072.000 67733146.500 67733221.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
67352245.000 67352319.500 67352394.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
69778027.000 69778101.500 69778176.000
USDA-MARC v1 (A): 14 Pig
chromosome 14
80.900 80.900 80.900
USDA-MARC v2 (A): 14 Pig
chromosome 14
45.200 45.200 45.200


© The Roslin Institute 2007-2012, all rights reserved