This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00003059


Marker Name:  SW1031 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8138161

PCR Primers

Primer: ATCACCCAGACAAAACAATCTC
Primer: TATGTCAACCCCAAACCCC
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
NIAI-Japan QTL v2 (A): 17 Pig
chromosome 17
54.900 54.900 54.900
NIAI-Japan v1 (A): 17 Pig
chromosome 17
47.600 47.600 47.600
NIAI-Japan v1 (F): 17 Pig
chromosome 17
71.800 71.800 71.800
NIAI-Japan v1 (M): 17 Pig
chromosome 17
24.000 24.000 24.000
USDA-MARC current (A): 17 Pig
chromosome 17
63.400 63.400 63.400
USDA-MARC v1 (A): 17 Pig
chromosome 17
50.300 50.300 50.300
USDA-MARC v2 (A): 17 Pig
chromosome 17
63.400 63.400 63.400


© The Roslin Institute 2007-2012, all rights reserved