This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002641


Marker Name:  S0352 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TCAGGCTCTTTGCCCAAGCATT
Primer: TAGATGCAAACTATTCCATTTAGA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008370
has an Associated Sequence: Sequence Genbank ID: L31356
has an Associated Sequence: Sequence Genbank ID: L31354

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
139556479.000 139557964.000 139559449.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
139301774.000 139303259.000 139304744.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
144444348.000 144445833.000 144447318.000
USDA-MARC v2 (A): 3 Pig
chromosome 3
79.500 79.500 79.500


© The Roslin Institute 2007-2012, all rights reserved