This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002635


Marker Name:  S0332 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 8743988

PCR Primers

Primer: TGGTTTCCTCACCAAGACAAGTAC
Primer: CCCAAGGAGCTACAGCAAGGCAAG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008366

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
51961979.000 51962056.000 51962133.000
ENSEMBL56 Sscrofa9 Pig Assembly: 17 Pig
chromosome 17
59886620.000 59886697.000 59886774.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
64515422.000 64515499.000 64515576.000
NIAI-Japan QTL v2 (A): 17 Pig
chromosome 17
86.200 86.200 86.200
NIAI-Japan v1 (A): 17 Pig
chromosome 17
77.500 77.500 77.500
NIAI-Japan v1 (F): 17 Pig
chromosome 17
110.000 110.000 110.000
NIAI-Japan v1 (M): 17 Pig
chromosome 17
45.900 45.900 45.900
USDA-MARC current (A): 17 Pig
chromosome 17
88.700 88.700 88.700
USDA-MARC v2 (A): 17 Pig
chromosome 17
88.700 88.700 88.700


© The Roslin Institute 2007-2012, all rights reserved