This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002600


Marker Name:  S0296 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: TGAAAAATAACAAGAACCAC
Primer: AAAAGCAAATAATGATAATAG
 

Related Sequences

No Associated Sequences Found.


Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
12885846.000 12885933.000 12886020.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 17 Pig
chromosome 17
12656457.000 12656545.000 12656633.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 7 Pig
chromosome 7
74183293.000 74183380.000 74183467.000
ENSEMBL67 Ssc10.2 Pig Assembly: 17 Pig
chromosome 17
17147298.000 17147385.000 17147472.000
Nordic v2 (A): 17 Pig
chromosome 17
36.800 36.800 36.800
Nordic v2 (F): 17 Pig
chromosome 17
36.500 36.500 36.500
Nordic v2 (M): 17 Pig
chromosome 17
37.100 37.100 37.100
PiGMaP v1 (A): 17 Pig
chromosome 17
46.000 46.000 46.000
PiGMaP v1 (F): 17 Pig
chromosome 17
100.000 100.000 100.000
PiGMaP v1 (M): 17 Pig
chromosome 17
17.000 17.000 17.000
USDA-MARC current (A): 17 Pig
chromosome 17
32.000 32.000 32.000
USDA-MARC v2 (A): 17 Pig
chromosome 17
32.000 32.000 32.000


© The Roslin Institute 2007-2012, all rights reserved