This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002591


Marker Name:  S0293 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: TCAGCTGGACAGGCATTATTATCAC
Primer: GGGTTCCAGTTCCAGCTCATCA
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X79922

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Jann et al. 2009: 13 Pig
chromosome 13
1619.500 1619.500 1619.500
PiGMaP v1 (A): 13 Pig
chromosome 13
94.000 94.000 94.000
PiGMaP v1 (F): 13 Pig
chromosome 13
96.000 96.000 96.000
PiGMaP v1 (M): 13 Pig
chromosome 13
89.000 89.000 89.000
USDA-MARC v2 (A): 13 Pig
chromosome 13
63.200 63.200 63.200


© The Roslin Institute 2007-2012, all rights reserved