This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002589


Marker Name:  S0291 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: GGAGGGACCCATCTGACAGGA
Primer: TTTTGGTGGGACGCTCCTGAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X79920

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Jann et al. 2009: 13 Pig
chromosome 13
2669.000 2669.000 2669.000
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
159.300 159.300 159.300
NIAI-Japan v1 (A): 13 Pig
chromosome 13
142.800 142.800 142.800
NIAI-Japan v1 (F): 13 Pig
chromosome 13
160.400 160.400 160.400
NIAI-Japan v1 (M): 13 Pig
chromosome 13
125.900 125.900 125.900
Nordic v2 (A): 13 Pig
chromosome 13
169.500 169.500 169.500
Nordic v2 (F): 13 Pig
chromosome 13
164.600 164.600 164.600
Nordic v2 (M): 13 Pig
chromosome 13
177.300 177.300 177.300
PiGMaP v1 (A): 13 Pig
chromosome 13
161.000 161.000 161.000
PiGMaP v1 (F): 13 Pig
chromosome 13
159.000 159.000 159.000
PiGMaP v1 (M): 13 Pig
chromosome 13
163.000 163.000 163.000
USDA-MARC v2 (A): 13 Pig
chromosome 13
126.200 126.200 126.200
Zhang, Jingu et al 2007 (A): 13 Pig
chromosome 13
178.300 178.300 178.300
Zhang, Jingu et al 2007 (F): 13 Pig
chromosome 13
157.100 157.100 157.100
Zhang, Jingu et al 2007 (M): 13 Pig
chromosome 13
187.400 187.400 187.400


© The Roslin Institute 2007-2012, all rights reserved