This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002587


Marker Name:  S0289 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: AGGAGCATTTGGCCACGTCTG
Primer: TGTTGACCTTCTGTGATGGGGC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008349
has an Associated Sequence: Sequence Genbank ID: X79918

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
130765126.000 130765194.500 130765263.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
140303322.000 140303390.500 140303459.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
209900460.000 209900528.500 209900597.000
Jann et al. 2009: 13 Pig
chromosome 13
2501.600 2501.600 2501.600
PiGMaP v1 (A): 13 Pig
chromosome 13
150.000 150.000 150.000
PiGMaP v1 (F): 13 Pig
chromosome 13
147.000 147.000 147.000
PiGMaP v1 (M): 13 Pig
chromosome 13
148.000 148.000 148.000
USDA-MARC v2 (A): 13 Pig
chromosome 13
112.100 112.100 112.100


© The Roslin Institute 2007-2012, all rights reserved