This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002584


Marker Name:  S0286 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: GGTAACCTCTGTATGCTGTGGGA
Primer: CCTTAACCTGCTGAGCCACCA
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008346
has an Associated Sequence: Local Sequence ID: ARKFSQ00008348
has an Associated Sequence: Sequence Genbank ID: X79915
has an Associated Sequence: Local Sequence ID: ARKFSQ00008347

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
2568722.000 2568770.000 2568818.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
2568583.000 2568647.000 2568711.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
2568583.000 2568700.500 2568818.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
2455684.000 2455748.000 2455812.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
2455684.000 2455801.500 2455919.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
2455823.000 2455871.000 2455919.000
PiGMaP v1 (A): 13 Pig
chromosome 13
9.000 9.000 9.000
PiGMaP v1 (F): 13 Pig
chromosome 13
10.000 10.000 10.000
PiGMaP v1 (M): 13 Pig
chromosome 13
8.000 8.000 8.000


© The Roslin Institute 2007-2012, all rights reserved