This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002581


Marker Name:  S0283 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: AGCAGCCCTAGAAATAGCAAGCGC
Primer: CTCTCTGTTCCTGGCACCTGGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008343
has an Associated Sequence: Sequence Genbank ID: X79925

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
94369614.000 94369684.500 94369755.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
101982738.000 101982808.500 101982879.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
145083047.000 145083121.500 145083196.000
PiGMaP v1 (A): 13 Pig
chromosome 13
96.000 96.000 96.000
PiGMaP v1 (F): 13 Pig
chromosome 13
99.000 99.000 99.000
PiGMaP v1 (M): 13 Pig
chromosome 13
92.000 92.000 92.000
USDA-MARC v2 (A): 13 Pig
chromosome 13
64.800 64.800 64.800


© The Roslin Institute 2007-2012, all rights reserved