This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002579


Marker Name:  S0282 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: AACTTCCATATGCCACAGGTGC
Primer: AGTGGAACAGAATGGAGAGCCC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: X79924
has an Associated Sequence: Local Sequence ID: ARKFSQ00008342

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
2729639.000 2729699.500 2729760.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
2649686.000 2649746.500 2649807.000
Jann et al. 2009: 13 Pig
chromosome 13
89.500 89.500 89.500
NIAI-Japan QTL v2 (A): 13 Pig
chromosome 13
0.000 0.000 0.000
NIAI-Japan v1 (A): 13 Pig
chromosome 13
0.000 0.000 0.000
NIAI-Japan v1 (F): 13 Pig
chromosome 13
0.000 0.000 0.000
NIAI-Japan v1 (M): 13 Pig
chromosome 13
0.000 0.000 0.000
Nordic v2 (A): 13 Pig
chromosome 13
0.000 0.000 0.000
Nordic v2 (F): 13 Pig
chromosome 13
0.000 0.000 0.000
Nordic v2 (M): 13 Pig
chromosome 13
0.000 0.000 0.000
PiGMaP v1 (A): 13 Pig
chromosome 13
0.000 0.000 0.000
PiGMaP v1 (F): 13 Pig
chromosome 13
0.000 0.000 0.000
PiGMaP v1 (M): 13 Pig
chromosome 13
0.000 0.000 0.000
USDA-MARC v2 (A): 13 Pig
chromosome 13
0.000 0.000 0.000


© The Roslin Institute 2007-2012, all rights reserved