This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002559


Marker Name:  S0215 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: TAGGCTCAGACCCTGCTGCAT
Primer: TGGGAGGCTGAAGGATTGGGT
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L31158
has an Associated Sequence: Local Sequence ID: ARKFSQ00008330

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 13 Pig
chromosome 13
133296531.000 133296608.000 133296685.000
ENSEMBL56 Sscrofa9 Pig Assembly: 13 Pig
chromosome 13
143050754.000 143050831.000 143050908.000
ENSEMBL67 Ssc10.2 Pig Assembly: 13 Pig
chromosome 13
212672130.000 212672207.000 212672284.000
Jann et al. 2009: 13 Pig
chromosome 13
2593.700 2593.700 2593.700
PiGMaP v1 (A): 13 Pig
chromosome 13
154.000 154.000 154.000
PiGMaP v1 (F): 13 Pig
chromosome 13
152.000 152.000 152.000
PiGMaP v1 (M): 13 Pig
chromosome 13
153.000 153.000 153.000
USDA-MARC v2 (A): 13 Pig
chromosome 13
121.200 121.200 121.200


© The Roslin Institute 2007-2012, all rights reserved