This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002554


Marker Name:  S0212 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: CCACGACTCAAACCTTAG
Primer: TCTTTCTTAGAATATCTCACAT
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008328
has an Associated Sequence: Sequence Genbank ID: L29231

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 7 Pig
chromosome 7
124824421.000 124824540.000 124824659.000
ENSEMBL56 Sscrofa9 Pig Assembly: 7 Pig
chromosome 7
125420467.000 125420586.000 125420705.000
ENSEMBL67 Ssc10.2 Pig Assembly: 7 Pig
chromosome 7
123806576.000 123806695.000 123806814.000
Fontanesi, L et al 2003 (A): 7 Pig
chromosome 7
81.300 81.300 81.300
PiGMaP v1 (A): 7 Pig
chromosome 7
170.000 170.000 170.000
PiGMaP v1 (F): 7 Pig
chromosome 7
186.000 186.000 186.000
PiGMaP v1 (M): 7 Pig
chromosome 7
153.000 153.000 153.000
USDA-MARC v2 (A): 7 Pig
chromosome 7
141.200 141.200 141.200
Wilkie PJ et al 1996 (A): 7 Pig
chromosome 7
142.300 142.300 142.300
Zhang, Jingu et al 2007 (A): 7 Pig
chromosome 7
191.700 191.700 191.700
Zhang, Jingu et al 2007 (F): 7 Pig
chromosome 7
193.100 193.100 193.100
Zhang, Jingu et al 2007 (M): 7 Pig
chromosome 7
215.800 215.800 215.800


© The Roslin Institute 2007-2012, all rights reserved