This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002553


Marker Name:  S0211 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: CTGCTCTTGGCTGGACTGA
Primer: GCCCAAGAAATAGCAACAAC
 

Related Sequences

has an Associated Sequence: Sequence Genbank ID: L30153
has an Associated Sequence: Local Sequence ID: ARKFSQ00008327

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
32479601.000 32479743.000 32479885.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
32142155.000 32142297.000 32142439.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
34037087.000 34037229.000 34037371.000
PiGMaP SSC14 v1.5 (A): 14 Pig
chromosome 14
33.700 33.700 33.700
PiGMaP SSC14 v1.5 (F): 14 Pig
chromosome 14
32.700 32.700 32.700
PiGMaP SSC14 v1.5 (M): 14 Pig
chromosome 14
24.500 24.500 24.500
PiGMaP v1 (A): 14 Pig
chromosome 14
30.000 30.000 30.000
PiGMaP v1 (F): 14 Pig
chromosome 14
23.000 23.000 23.000
PiGMaP v1 (M): 14 Pig
chromosome 14
24.000 24.000 24.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
33.600 33.600 33.600


© The Roslin Institute 2007-2012, all rights reserved