This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002508


Marker Name:  S0162 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7982563

PCR Primers

Primer: GTCAGTGACTCCCATACAACCTTG
Primer: AGGAAACCAAGCCTCAGAGACTGG
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008313

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
ENSEMBL52PRE Sscrofa8 Pig Assembly: 14 Pig
chromosome 14
47701352.000 47701425.000 47701498.000
ENSEMBL56 Sscrofa9 Pig Assembly: 14 Pig
chromosome 14
47280616.000 47280689.000 47280762.000
ENSEMBL67 Ssc10.2 Pig Assembly: 14 Pig
chromosome 14
49769477.000 49769547.000 49769617.000
Nordic v1 (A): 14 Pig
chromosome 14
44.000 44.000 44.000
Nordic v2 (A): 14 Pig
chromosome 14
53.200 53.200 53.200
Nordic v2 (F): 14 Pig
chromosome 14
54.600 54.600 54.600
Nordic v2 (M): 14 Pig
chromosome 14
48.400 48.400 48.400
PiGMaP SSC14 v1.5 (A): 14 Pig
chromosome 14
87.200 87.200 87.200
PiGMaP SSC14 v1.5 (F): 14 Pig
chromosome 14
84.900 84.900 84.900
PiGMaP SSC14 v1.5 (M): 14 Pig
chromosome 14
90.400 90.400 90.400
PiGMaP v1 (A): 14 Pig
chromosome 14
55.000 55.000 55.000
PiGMaP v1 (F): 14 Pig
chromosome 14
48.000 48.000 48.000
PiGMaP v1 (M): 14 Pig
chromosome 14
64.000 64.000 64.000
USDA-MARC v2 (A): 14 Pig
chromosome 14
38.500 38.500 38.500


© The Roslin Institute 2007-2012, all rights reserved