This site is hosted at The Roslin Institute using funds from BBSRC

Marker Details for ARKMKR00002495


Marker Name:  S0143 
Species:  Pig
Marker Type:  Microsatellite
Publication ID: 7749223

PCR Primers

Primer: ACTCACAGCTTGTCCTGGGTGT
Primer: CAGTCAGCAGGCTGACAAAAAC
 

Related Sequences

has an Associated Sequence: Local Sequence ID: ARKFSQ00008304
has an Associated Sequence: Local Sequence ID: ARKFSQ00008305

Related Markers

No Related Markers Found.

Related Maps

  Map Name Species Start
Position
Middle
Position
End
Position
Clop, Alex et al 2003 (A): 12 Pig
chromosome 12
0.000 0.000 0.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 12 Pig
chromosome 12
2014254.000 2014331.500 2014409.000
ENSEMBL52PRE Sscrofa8 Pig Assembly: 12 Pig
chromosome 12
1878533.000 1878613.500 1878694.000
ENSEMBL56 Sscrofa9 Pig Assembly: 12 Pig
chromosome 12
3227428.000 3227508.500 3227589.000
ENSEMBL56 Sscrofa9 Pig Assembly: 12 Pig
chromosome 12
3244035.000 3244112.500 3244190.000
ENSEMBL67 Ssc10.2 Pig Assembly: 12 Pig
chromosome 12
4823589.000 4823669.500 4823750.000
Fontanesi, L et al 2003 (A): 12 Pig
chromosome 12
0.000 0.000 0.000
NIAI-Japan QTL v2 (A): 12 Pig
chromosome 12
8.200 8.200 8.200
PiGMaP v1 (A): 12 Pig
chromosome 12
0.000 0.000 0.000
PiGMaP v1 (F): 12 Pig
chromosome 12
0.000 0.000 0.000
PiGMaP v1 (M): 12 Pig
chromosome 12
0.000 0.000 0.000
USDA-MARC v2 (A): 12 Pig
chromosome 12
6.600 6.600 6.600


© The Roslin Institute 2007-2012, all rights reserved